Skip to content

NCBI #
Find similar titles

Structured data

Category
Business

NCBI는 National Center for Biotechnology Information의 약어로 생물정보학을 공부하거나 주업종으로 하는 사람이면 누구나 한번쯤 접속해서 BLAST를 돌려보던지, 아니면 서열데이터를 다운로드 받아본 경험이 있을 것이다.

NCBI 소개 #

NCBI 역사 #

사실 NCBI는 내 나이 겨우 6살때 미국 메릴랜드 주에 설립되었다고 한다.

미국 국립생물공학정보센터(National Center for Biotechnology Information(NCBI))는 미국 보건성 산하 국립의학도서관의 운영 분야 중 하나이다. NCBI는 1988년 미국 메릴랜드 주(북위 38.994994° 서경 77.099339°좌표: 북위 38.994994° 서경 77.099339°)에 설립되었다. NCBI는 생명과학 및 의학 논문 인덱스의 데이터베이스인 펍메드(PubMed), 유전체 서열 데이터베이스인 진뱅크(GenBank)를 비롯하여 각종 생명공학 정보들을 담고 있으며, 이 모든 정보들은 Entrez 검색엔진을 이용하여 온라인으로 열람할 수 있다. - 위키피디아 발췌

NCBI 주요서비스 #

주요 NCBI에서 서비스 하는 항목은 PubMed, Blast, Gene, EST, Genome, Nucleotide, SNP, Protein 등이 있으며 그 이외에도 무수한 서비스를 지원하고 있다.

NCBI 응용 #

NCBI EUTils #

생물학관련 프로그래밍을 하다보면 NCBI로 쿼리를 보내고 결과를 받아야하는 경우가 종종생긴다. 그것을 쉽게 하기 위해 NCBI에서 Entrez utils를 제공하고 있다. 지원하는 프로그램의 종류는 아래와 같다.

  1. Einfo
  2. Esearch
  3. Esummary
  4. Elink

NCBI 서열 등록 #

Information #

Step #

  1. Bioproject assignment
  2. .fsa file making

    • .fsa file => genomic DNA sequence with fasta format
    • information of title line

      Biological strain [strain=S288C]
      isolate [isolate=CWS1]
      chromosome [chromosome=XVI]
      Other elements topology [topology=circular]
      location [location=mitochondrion]
      molecule [moltype=mRNA] (DNA is the default)
      technique [tech=wgs]
      genetic code [gcode=4]
    • example

      >NCCP15744_chromosome1contig75 [organism=Shigella flexneri] [strain=II:(3)4,7(8)str.NCCP 15744] [chromosome=I] [moltype=genomic]
      ACTTTTTACCACCCTGCCTTTAACGCCTATGGCCCATGCTTCAAAGCAAGCCAGGGAGAG
      TTCTGCTACCACTCATATCACCAAAAAAGCAGATAAAAAGAAAAGCACGGCAACCACCAA
      AAAGACCCAGAAAGCCAGCCAGAAAACAGCGAAAAAAGCCGCCAGTAAAAGTATGACCAA
      AAGCAAAACCGCTTCTTCTGTTAAAAAATCTTCCATTACCGCTTCTAAAAACGCCAAAAC
      TCGCAGCAAACACGCCGTCAATAAAACGGCCTCAGCCAGCTTTACCGAAAAGTGTACCAA
      ACGTAAGGGCTATAAATCGCATTGTGTGAAAGTCAAAAATGCCGCGTCAGGAACCCTTGC
      CGACGCGCACAAAGCGAAGGTGCAAAAAGCCACGAAAGTGGCAATGAATAAACTGATGCA
      GCAAATTGGTAAGCCATATCGTTGGGGCGGCAGCTCACCGCGTACCGGTTTTGATTGCAG
      CGGCCTGGTTTATTACGCTTATAAAGATTTGGTGAAAATTCGTATTCCGCGTACGGCGAA
      TGAAATGTATCACCTGCGTGATGCAGGACCTATCGAACGTAGTGAGCTGAAAAACGG
      
  3. .sbt file making

  4. .sqn file making

  5. File uploading

Incoming Links #

Related Data Sciences #

Related Articles #

Related Bioinformaticses #

Suggested Pages #

0.0.1_20140628_0