Skip to content

Ion Torrent #
Find similar titles

Structured data

Category
Experiment

정의 #

Life technology사에서 제작한 Sequencing 플랫폼이다. Ion Torrent를 만든 Jonathan Rothberg라는 사람은 기존 NGS Sequencing 플랫폼인 로슈 454를 만들어서 새로운 NGS시대를 열었다.

원리 #

비즈에서 증폭된 DNA 사슬에서 A,T,C,G 네 가지 염기를 순서대로 넣어주고 상보적으로 결합하는 염기가 있을 경우, 수소이온이 방출하게 된다. 수소이온이 방출하면서 pH변화에 따른 전기 신호가 바뀐다. 그후 이 신호를 잡아주고 신호가 나오지 않으면 전부 씻어내고 다시 다음 염기를 넣어준다. 그리고 이 과정은 모두 반도체 칩에서 이루어진다.

장점 #

반도체 Sequencing은 기존의 형광을 이용한 방법이 아니고 칩안에 많은 구멍들 안에서 합성이 일어난다. 형광을 쓰지 않기 때문에 형광을 읽는 카메라와 스캐너 같은 기기들이 필요가 없다는 장점이 있다. 때문에 해독기기 자체가 매우 소형화되어 있으며 해독에 걸리는 시간이 빠르다. 기존의 Illumina MiSeq으로 미생물 유전체 해독결과를 발표하고 뒤이어 Ion Torrent가 비교결과를 발표하는 등, MiSeq과 경쟁을 이루면서 유전체 연구가 진행되고 있다.

단점 #

30억쌍에 가까운 인간의 전체 염기서열을 읽는 것은 무리가 있고 Target Sequencing에 유용하다.

Tips #

Ion torrent Proton paired-end reads #

Ion torrent Proton의 경우 paired-end reads로 시퀀싱 결과로 제공하는데 이때 일반적인 Illumina의 paired-end와 라이브러리 구축 방법에서 차이가 나고 이로 인해 결과 상에서도 일부 차이를 보인다. Ion torrent Proton의 paired-end는 A, B, P1 3개의 adapter 서열을 이용하여 라이브러리를 구축하고 시퀀싱을 수행하게 되는데 이때 A dapter 말단에서 시퀀싱이 시작되고 B/P1 adapter는 DNA fragment 말단에 위치하여 beads에 결합하게 된다. 이로 인해 만약 DNA fragment의 길이가 짧으면 B/P1 adapter까지 같이 읽히게 되는 것이다. 따라서 Ion torrent Proton의 paired-end reads에는 B/P1 adapter가 존재할 확률이 높으며 이 서열을 제거 후 분석을 수행하여야 한다. Ion torrent Proton의 adapter 정보는 다음과 같다.

P1 :  CCTCTCTATGGGCAGTCGGTGAT 
B : CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 
A : CCATCTCATCCCTGCGTGTCTCCGACTCAG

출처 #

Incoming Links #

Related Bioinformaticses #

Suggested Pages #

0.0.1_20140628_0