Skip to content

GenoTan Results #
Find similar titles

Structured data

Category
Software

결과의 해석 #

GenoTan의 output은 예측된 microsatellites 위치에서의 major allele과 minor allele이 어떤 스코어값으로 구성되는지 보여준다. 결과파일을 보면 크게 3가지 타입이 있다. 각각의 경우를 보면 결과파일에서 allele 에 대한 score 값이 주어진 cutoff confidence score 보다 낮을 때, 하나의 allele candidate 가 지워진다. Cutoff confidence score는 Lhigh 0.35, Llow 0.25 로 default 설정되어있다. 여기서 주의할 것은 major allele score 값이 해당 allele 의 ratio가 아닌 해당 genotype이 갖는 socre라는 점이다. 예를 들어 정리하면, marker 에서 나타난 genotype 의 종류별로 score 가 계산되고, minor score 값이 0.25 가 넘을 경우에 해당 marker가 hetero하다 라고 출력한다.

copy number 가 다른 polymorphic ssr motif가 확인된 경우. #

ref1     2658     2689     32     32(0:0)     36(0:0)     0.828     0.452     CACGCACGCACGCACGCACGCACGCACGCACG     CACGCACGCACGCACGCACGCACGCACGCACGCACG

homozygous locus 가 확인된 경우. #

ref2     1162     1181     20     20(0:0)     20(0:0)     0.935     0.935     ACACACACACACACACACAC     -

homozygous locus는 아닌데, heterozygous 라고 보기에는 확신이 안되는 경우 #

ref3     1027     1053     27     27(0:0)     -1(0:0)     0.891     0.000     TCCTCCTCCTCCTCCTCCTCCTCCTCC     ?
0.0.1_20140628_0