Skip to content

FASTA #
Find similar titles

Structured data

Category
Analysis

FASTA #

  • Nucleotide 서열이나 amino acid 서열을 표기하는 가장 단순한 형식
  • 꺽쇠('''>''')로 시작하는 라인에 ID와 description을 입력
  • 아래 BRCA1 유전자의 경우 '''gi|2695690|gb|AF036760.1|'''이 ID이고 한 칸의 공백 이후는 모두 description
  • Genbank의 서열들은 한 서열에 두 개 이상의 ID체계가 부여되는 경우가 있어서 바(bar, '|')로 구분해서 보여주기도 함
  • 그 다음 라인부터 IUPAC명명법에 따라 nucleotide 또는 amino acid 서열을 one-letter-code로 입력
  • 한 줄에 최대 80자씩 끊어서 줄을 바꿔가며 입력하도록 권장
  • 하지만 한 줄에 모든 서열을 쭉 나열해도 대부분의 프로그램들이 인식(가독성을 위한 지침인듯)

    >gi|2695690|gb|AF036760.1| Rattus norvegicus BRCA1 mRNA, complete cds
    CGCTGGTGCAACTCGAAGACCTATCTCCTTCCCGGGGGGGCTTCTCCGGCATTTAGGCCTCGGCGTTTGG
    AAGTACGGAGGTTTTTCTCGGAAGAAAGTTCACTGGAAGTGGAAGAAATGGATTTATCTGCTGTTCGAAT
    

Multi-fasta의 경우 '>' 기호로 여러개의 서열이 구분된다.

Incoming Links #

Related Data Sciences #

Related Articles #

Related Bioinformaticses #

Suggested Pages #

0.0.1_20140628_0